Sample ID: FungusB_Btub
[analysis description + link to github repo]
| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-05-03 01:28:15 |
| Analysis completed | 2025-05-03 01:28:15 |
| Wall time | 0:0:0 hours |
Inconclusive
Outcome: The analyst should attempt subjective species identification at the genus level.
Reasoning: [Flag 1C] >3 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed? | NA |
|
Inconclusive taxonomic identity (Flag 1C) Fungi. |
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
No database coverage information is available for this taxon. This is likely because the data are insufficient or inappropriate for this analysis, or because an error was encountered during the analysis.
No taxa of interest provided at rank genus/species
| Locus | ß-tub |
| Preliminary ID | Fungi |
| Taxa of interest | |
| Country | Australia |
| Host | Vitis vinifera |
| Sample ID | FungusB_Btub |
| Query DNA sequence |
>FungusB_Btub ATTGTAAGTACCTGCGCCTGCCCGCTTGTTTTTCTACGCGTCCCCTGACAGCCCCGCGTC TTGCCCCCCGGCTACGACAACGGGGTCAACACCGCTGCGCACTCGTGCTAACGTCGTCTT TTCGCATCCATAGGTTCACCTCCAGACCGGCCAATGCGTAAGTCTCCTCACATCCGCTGG AATCGCTGCATCGCGCTGACTTTGCCCAGGGTAACCAAATCGGTGCTGCCTTCTGGTTTG TTGCCAAAACACCGCCGCTCCCGCGCTCCCGCTGACGCGAATCGACACCGCAGGCAGACC ATTTCTGGCGAGCACGGCCTGGACGGCTCTGGCGTGTAAGTCTGCGCCGTTTCTTGCGCG AATGGCAATGGCTGACCCGCAGCAGCTACAATGGCACCTCCGACCTCCAGCTCGAGCGCA TGAACGTCTACTTCAACGAGGTACTCTCTCACTAATCGCACAAACACGTAAAGTATGGCA ATCTTCTGAACGCGCAGCAGGCGTCGAACAACAAGTACGTTCCTCGTGCCGTCCTCGTCG ACCTCGAGCCCGGCACCATGGATGCCGTCCGCGCCGGCCCCTTCGGCCAGCTCTTCCGCC CCGACAACTTTGTCTTCGGCCAGTCTGGTGCCGGTAACAACTGGGCCAAG
Flag 1C:
The analyst should attempt subjective species identification at the genus level
>3 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits have then been classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 216 | 7 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
| Species | Hits | Identity | E-value | Database coverage |
|---|---|---|---|---|
| Neofusicoccum australe | 91 | 100.0% | 0.0 |
Database coverage of Candidate Neofusicoccum australeThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Neofusicoccum stellenboschiana | 16 | 99.6% | 0.0 |
Database coverage of Candidate Neofusicoccum stellenboschianaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Neofusicoccum cryptoaustrale | 28 | 99.5% | 0.0 |
Database coverage of Candidate Neofusicoccum cryptoaustraleThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Neofusicoccum luteum | 72 | 99.5% | 0.0 |
Database coverage of Candidate Neofusicoccum luteumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Neofusicoccum laricinum | 2 | 99.1% | 0.0 |
Database coverage of Candidate Neofusicoccum laricinumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Neofusicoccum mangroviorum | 6 | 99.0% | 0.0 |
Database coverage of Candidate Neofusicoccum mangroviorumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Neofusicoccum lumnitzerae | 1 | 98.6% | 0.0 |
Database coverage of Candidate Neofusicoccum lumnitzeraeThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| # | Accession | Hit subject | Align length | Query coverage | Bitscore | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | GU251879 | Neofusicoccum australe strain PD253 beta tubulin gene, partial cds | 489 | 75.2% | 969.819 | 0.00e+00 | 100.0% |
| 2 | KX505927 | Neofusicoccum australe strain CAA434 beta-tubulin gene, partial cds | 441 | 67.8% | 874.67 | 0.00e+00 | 100.0% |
| 3 | KX464937 | Neofusicoccum australe culture CBS:110865 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 848.901 | 0.00e+00 | 100.0% |
| 4 | MT592668 | Neofusicoccum australe culture CPC:29004 beta-tubulin (tub2) gene, partial cds | 420 | 64.6% | 833.043 | 0.00e+00 | 100.0% |
| 5 | JN595816 | Neofusicoccum australe isolate 10720 beta-tubulin gene, partial sequence | 419 | 64.5% | 831.06 | 0.00e+00 | 100.0% |
| 6 | OQ181384 | Neofusicoccum australe isolate B018 beta-tubulin (TUB2) gene, partial cds | 411 | 63.2% | 815.202 | 0.00e+00 | 100.0% |
| 7 | DQ008346 | Botryosphaeria australis strain UCD1314So beta-tubulin gene, partial sequence | 409 | 62.9% | 811.238 | 0.00e+00 | 100.0% |
| 8 | MT309395 | Neofusicoccum australe strain CAA919 beta-tubulin (TUB) gene, partial cds | 397 | 61.1% | 787.45 | 0.00e+00 | 100.0% |
| 9 | JX679868 | Neofusicoccum australe isolate Vid-1559 beta-tubulin (tub2) gene, partial cds | 394 | 60.6% | 781.504 | 0.00e+00 | 100.0% |
| 10 | MT347843 | Neofusicoccum australe strain ID0506 beta-tublin gene, partial cds | 389 | 59.8% | 771.592 | 0.00e+00 | 100.0% |
| 11 | MT347841 | Neofusicoccum australe strain ID0659 beta-tublin gene, partial cds | 389 | 59.8% | 771.592 | 0.00e+00 | 100.0% |
| 12 | MT347848 | Neofusicoccum australe strain ID0508 beta-tublin gene, partial cds | 389 | 59.8% | 771.592 | 0.00e+00 | 100.0% |
| 13 | MT347847 | Neofusicoccum australe strain ID0657 beta-tublin gene, partial cds | 389 | 59.8% | 771.592 | 0.00e+00 | 100.0% |
| 14 | MT347838 | Neofusicoccum australe strain ID0677 beta-tublin gene, partial cds | 389 | 59.8% | 771.592 | 0.00e+00 | 100.0% |
| 15 | MT347835 | Neofusicoccum australe strain ID0682 beta-tublin gene, partial cds | 389 | 59.8% | 771.592 | 0.00e+00 | 100.0% |
| 16 | MT347844 | Neofusicoccum australe strain ID0403 beta-tublin gene, partial cds | 389 | 59.8% | 771.592 | 0.00e+00 | 100.0% |
| 17 | MT347837 | Neofusicoccum australe strain ID0679 beta-tublin gene, partial cds | 389 | 59.8% | 771.592 | 0.00e+00 | 100.0% |
| 18 | MT347839 | Neofusicoccum australe strain ID0672 beta-tublin gene, partial cds | 389 | 59.8% | 771.592 | 0.00e+00 | 100.0% |
| 19 | MT347842 | Neofusicoccum australe strain ID0656 beta-tublin gene, partial cds | 389 | 59.8% | 771.592 | 0.00e+00 | 100.0% |
| 20 | MT347840 | Neofusicoccum australe strain ID0671 beta-tublin gene, partial cds | 389 | 59.8% | 771.592 | 0.00e+00 | 100.0% |
| 21 | MT347849 | Neofusicoccum australe strain ID0498 beta-tublin gene, partial cds | 389 | 59.8% | 771.592 | 0.00e+00 | 100.0% |
| 22 | MT347845 | Neofusicoccum australe strain ID0395 beta-tublin gene, partial cds | 389 | 59.8% | 771.592 | 0.00e+00 | 100.0% |
| 23 | MT347836 | Neofusicoccum australe strain ID0681 beta-tublin gene, partial cds | 389 | 59.8% | 771.592 | 0.00e+00 | 100.0% |
| 24 | MT347846 | Neofusicoccum australe strain ID0676 beta-tublin gene, partial cds | 389 | 59.8% | 771.592 | 0.00e+00 | 100.0% |
| 25 | MT592674 | Neofusicoccum australe culture CPC:32013 beta-tubulin (tub2) gene, partial cds | 505 | 77.7% | 993.606 | 0.00e+00 | 99.8% |
| 26 | KX871745 | Neofusicoccum australe strain CAA648 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 27 | KX871724 | Neofusicoccum australe strain CAA344 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 28 | KX871753 | Neofusicoccum australe strain CAA751 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 29 | KX871713 | Neofusicoccum australe strain CAA197 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 30 | KX871729 | Neofusicoccum australe strain CAA398 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 31 | KX871720 | Neofusicoccum australe strain CAA326 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 32 | KX871733 | Neofusicoccum australe strain CAA420 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 33 | KX871722 | Neofusicoccum australe strain CAA332 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 34 | KX871717 | Neofusicoccum australe strain CAA242 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 35 | KX871742 | Neofusicoccum australe strain CAA550 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 36 | KX871732 | Neofusicoccum australe strain CAA406 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 37 | KX871728 | Neofusicoccum australe strain CAA392 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 38 | KX871748 | Neofusicoccum australe strain CAA741 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 39 | KX871749 | Neofusicoccum australe strain CAA743 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 40 | KX871750 | Neofusicoccum australe strain CAA747 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 41 | KX871747 | Neofusicoccum australe strain CAA723 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 42 | KX871721 | Neofusicoccum australe strain CAA327 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 43 | KX871727 | Neofusicoccum australe strain CAA359 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 44 | KX871741 | Neofusicoccum australe strain CAA549 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 45 | KX871714 | Neofusicoccum australe strain CAA202 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 46 | KX871718 | Neofusicoccum australe strain CAA319 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 47 | KX871726 | Neofusicoccum australe strain CAA357 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 48 | KX871740 | Neofusicoccum australe strain CAA546 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 49 | KX871738 | Neofusicoccum australe strain CAA468 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 50 | KX871736 | Neofusicoccum australe strain CAA464 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 51 | KX871710 | Neofusicoccum australe strain CAA184 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 52 | KX871730 | Neofusicoccum australe strain CAA400 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 53 | KX871723 | Neofusicoccum australe strain CAA341 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 54 | KX871709 | Neofusicoccum australe strain CAA178 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 55 | KX871739 | Neofusicoccum australe strain CAA475 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 56 | KX871735 | Neofusicoccum australe strain CAA441 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 57 | KX871716 | Neofusicoccum australe strain CAA233 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 58 | KX871743 | Neofusicoccum australe strain CAA571 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 59 | KX871744 | Neofusicoccum australe strain CAA647 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 60 | KX871711 | Neofusicoccum australe strain CAA191 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 61 | KX871731 | Neofusicoccum australe strain CAA401 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 62 | KX871751 | Neofusicoccum australe strain CAA749 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 63 | KX871746 | Neofusicoccum australe strain CAA649 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 64 | MT592653 | Neofusicoccum australe culture CBS:110851 beta-tubulin (tub2) gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 65 | KX871715 | Neofusicoccum australe strain CAA231 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 66 | KX871752 | Neofusicoccum australe strain CAA750 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 67 | KX871737 | Neofusicoccum australe strain CAA466 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 68 | KX871712 | Neofusicoccum australe strain CAA195 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 69 | KX871734 | Neofusicoccum australe strain CAA427 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 70 | KX871725 | Neofusicoccum australe strain CAA351 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 71 | KX871719 | Neofusicoccum australe strain CAA320 beta-tubulin gene, partial cds | 441 | 67.8% | 866.741 | 0.00e+00 | 99.8% |
| 72 | MT592673 | Neofusicoccum australe culture CPC:31418 beta-tubulin (tub2) gene, partial cds | 437 | 67.2% | 858.812 | 0.00e+00 | 99.8% |
| 73 | MT592659 | Neofusicoccum australe culture CBS:115502 beta-tubulin (tub2) gene, partial cds | 436 | 67.1% | 856.83 | 0.00e+00 | 99.8% |
| 74 | OL901311 | Neofusicoccum australe strain ICMP 17597 beta-tubulin (btub) gene, partial cds | 430 | 66.2% | 844.936 | 0.00e+00 | 99.8% |
| 75 | AY339252 | Botryosphaeria australis CMW9072 beta tubulin gene, exons 3 through 6 and partial cds | 430 | 66.2% | 844.936 | 0.00e+00 | 99.8% |
| 76 | HM176498 | Neofusicoccum australe strain CMW822 beta-tubulin (BT) gene, partial cds | 429 | 66.0% | 842.954 | 0.00e+00 | 99.8% |
| 77 | HM176497 | Neofusicoccum australe strain CMW821 beta-tubulin (BT) gene, partial cds | 429 | 66.0% | 842.954 | 0.00e+00 | 99.8% |
| 78 | KF955889 | Neofusicoccum australe strain 6B39 beta-tubulin gene, exons 3 through 6 and partial cds | 428 | 65.8% | 840.972 | 0.00e+00 | 99.8% |
| 79 | KX464931 | Neofusicoccum australe culture CBS:110490 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 840.972 | 0.00e+00 | 99.8% |
| 80 | KX464929 | Neofusicoccum australe culture CBS:110485 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 840.972 | 0.00e+00 | 99.8% |
| 81 | MT592654 | Neofusicoccum australe culture CBS:112877 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 838.989 | 0.00e+00 | 99.8% |
| 82 | MH118934 | Neofusicoccum australe isolate EFA 437 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 838.989 | 0.00e+00 | 99.8% |
| 83 | MT592662 | Neofusicoccum australe culture CBS:125786 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 838.989 | 0.00e+00 | 99.8% |
| 84 | MT592660 | Neofusicoccum australe culture CBS:119132 beta-tubulin (tub2) gene, partial cds | 426 | 65.5% | 837.007 | 0.00e+00 | 99.8% |
| 85 | AY339255 | Botryosphaeria australis CMW6853 beta tubulin gene, exons 3 through 6 and partial cds | 424 | 65.2% | 833.043 | 0.00e+00 | 99.8% |
| 86 | MT592669 | Neofusicoccum australe culture CPC:29026 beta-tubulin (tub2) gene, partial cds | 424 | 65.2% | 833.043 | 0.00e+00 | 99.8% |
| 87 | DQ093210 | Botryosphaeria australis strain CMW15954 beta-tubulin gene, partial cds | 423 | 65.1% | 831.06 | 0.00e+00 | 99.8% |
| 88 | AY615150 | Botryosphaeria australis isolate CMW1110 beta-tubulin gene, exons 3 through 6 and partial cds | 421 | 64.8% | 827.096 | 0.00e+00 | 99.8% |
| 89 | DQ093209 | Botryosphaeria australis strain WAC12399 beta-tubulin gene, partial cds | 420 | 64.6% | 825.113 | 0.00e+00 | 99.8% |
| 90 | EF591945 | Neofusicoccum australe strain MUCC479 beta-tubulin gene, partial sequence | 418 | 64.3% | 821.149 | 0.00e+00 | 99.8% |
| 91 | MT347823 | Neofusicoccum stellenboschiana strain ID0668 beta-tublin gene, partial cds | 389 | 59.8% | 763.663 | 0.00e+00 | 99.7% |
| 92 | MT347825 | Neofusicoccum stellenboschiana strain ID0673 beta-tublin gene, partial cds | 389 | 59.8% | 763.663 | 0.00e+00 | 99.7% |
| 93 | MT347829 | Neofusicoccum stellenboschiana strain ID0658 beta-tublin gene, partial cds | 389 | 59.8% | 763.663 | 0.00e+00 | 99.7% |
| 94 | MT347830 | Neofusicoccum stellenboschiana strain ID0495 beta-tublin gene, partial cds | 389 | 59.8% | 763.663 | 0.00e+00 | 99.7% |
| 95 | MT347826 | Neofusicoccum stellenboschiana strain ID0666 beta-tublin gene, partial cds | 389 | 59.8% | 763.663 | 0.00e+00 | 99.7% |
| 96 | MT347827 | Neofusicoccum stellenboschiana strain ID0665 beta-tublin gene, partial cds | 389 | 59.8% | 763.663 | 0.00e+00 | 99.7% |
| 97 | MT347824 | Neofusicoccum stellenboschiana strain ID0494 beta-tublin gene, partial cds | 389 | 59.8% | 763.663 | 0.00e+00 | 99.7% |
| 98 | MT347831 | Neofusicoccum stellenboschiana strain ID0501 beta-tublin gene, partial cds | 389 | 59.8% | 763.663 | 0.00e+00 | 99.7% |
| 99 | MT347822 | Neofusicoccum stellenboschiana strain ID0680 beta-tublin gene, partial cds | 389 | 59.8% | 763.663 | 0.00e+00 | 99.7% |
| 100 | MT347828 | Neofusicoccum stellenboschiana strain ID0661 beta-tublin gene, partial cds | 389 | 59.8% | 763.663 | 0.00e+00 | 99.7% |
| 101 | MT592734 | Neofusicoccum stellenboschiana culture CBS:110866 beta-tubulin (tub2) gene, partial cds | 496 | 76.3% | 967.836 | 0.00e+00 | 99.6% |
| 102 | MT592740 | Neofusicoccum stellenboschiana culture CPC:29767 beta-tubulin (tub2) gene, partial cds | 650 | 100.0% | 1265.18 | 0.00e+00 | 99.5% |
| 103 | OQ091956 | Neofusicoccum stellenboschiana CREA-DC TPR OL.60 beta-tubulin 2 (TUB2) gene, partial cds | 636 | 97.8% | 1237.42 | 0.00e+00 | 99.5% |
| 104 | OQ091957 | Neofusicoccum stellenboschiana CREA-DC TPR OL.431 beta-tubulin 2 (TUB2) gene, partial cds | 635 | 97.7% | 1235.44 | 0.00e+00 | 99.5% |
| 105 | OQ091959 | Neofusicoccum stellenboschiana CREA-DC TPR OL.453 beta-tubulin 2 (TUB2) gene, partial cds | 635 | 97.7% | 1235.44 | 0.00e+00 | 99.5% |
| 106 | OQ091958 | Neofusicoccum stellenboschiana CREA-DC TPR OL.438 beta-tubulin 2 (TUB2) gene, partial cds | 635 | 97.7% | 1235.44 | 0.00e+00 | 99.5% |
| 107 | KX505930 | Neofusicoccum cryptoaustrale strain LM03 beta-tubulin gene, partial cds | 441 | 67.8% | 858.812 | 0.00e+00 | 99.5% |
| 108 | KY775302 | Neofusicoccum australe strain STEU8044 beta-tubulin gene, exons 2 through 4 and partial cds | 433 | 66.6% | 842.954 | 0.00e+00 | 99.5% |
| 109 | ON086294 | Neofusicoccum australe strain ICMP 18453 beta-tubulin (btub) gene, partial cds | 432 | 66.5% | 840.972 | 0.00e+00 | 99.5% |
| 110 | OL901365 | Neofusicoccum australe strain ICMP 15810 beta-tubulin (btub) gene, partial cds | 430 | 66.2% | 837.007 | 0.00e+00 | 99.5% |
| 111 | KX465050 | Neofusicoccum stellenboschiana culture CBS:121561 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 833.043 | 0.00e+00 | 99.5% |
| 112 | KX464942 | Neofusicoccum australe culture CBS:112662 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 833.043 | 0.00e+00 | 99.5% |
| 113 | MT592672 | Neofusicoccum australe culture CPC:31414 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 833.043 | 0.00e+00 | 99.5% |
| 114 | MT592677 | Neofusicoccum australe culture CPC:32263 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 831.06 | 0.00e+00 | 99.5% |
| 115 | JQ918159 | Neofusicoccum australe isolate 11219_1 beta-tubulin gene, partial cds | 419 | 64.5% | 819.167 | 0.00e+00 | 99.5% |
| 116 | JQ918160 | Neofusicoccum australe isolate NZFS 3554 beta-tubulin gene, partial cds | 419 | 64.5% | 815.202 | 0.00e+00 | 99.5% |
| 117 | OQ181394 | Neofusicoccum cryptoaustrale isolate B055 beta-tubulin (TUB2) gene, partial cds | 411 | 63.2% | 799.344 | 0.00e+00 | 99.5% |
| 118 | OQ401620 | Neofusicoccum cryptoaustrale isolate B043 beta-tubulin (TUB2) gene, partial cds | 411 | 63.2% | 799.344 | 0.00e+00 | 99.5% |
| 119 | JX515686 | Neofusicoccum luteum strain UCD360-Oe beta-tubulin (BT) gene, partial cds | 411 | 63.2% | 799.344 | 0.00e+00 | 99.5% |
| 120 | OQ181393 | Neofusicoccum cryptoaustrale isolate B041 beta-tubulin (TUB2) gene, partial cds | 411 | 63.2% | 799.344 | 0.00e+00 | 99.5% |
| 121 | OQ401621 | Neofusicoccum cryptoaustrale isolate B029 beta-tubulin (TUB2) gene, partial cds | 411 | 63.2% | 799.344 | 0.00e+00 | 99.5% |
| 122 | OQ181395 | Neofusicoccum cryptoaustrale isolate B012 beta-tubulin (TUB2) gene, partial cds | 411 | 63.2% | 799.344 | 0.00e+00 | 99.5% |
| 123 | MT164530 | Neofusicoccum luteum isolate TN.41 beta-tubulin (tub2) gene, partial cds | 397 | 61.1% | 771.592 | 0.00e+00 | 99.5% |
| 124 | MT592739 | Neofusicoccum stellenboschiana culture CPC:28950 beta-tubulin (tub2) gene, partial cds | 643 | 98.9% | 1243.37 | 0.00e+00 | 99.4% |
| 125 | GU251881 | Neofusicoccum luteum strain PD285 beta tubulin gene, partial cds | 489 | 75.2% | 946.032 | 0.00e+00 | 99.4% |
| 126 | KU836639 | Neofusicoccum australe isolate CUZF10AV1 beta-tubulin gene, partial cds | 612 | 94.2% | 1179.94 | 0.00e+00 | 99.3% |
| 127 | EU375520 | Neofusicoccum australe isolate JL619 beta-tubulin gene, exons 3 through 6 and partial cds | 441 | 67.8% | 850.883 | 0.00e+00 | 99.3% |
| 128 | KY000205 | Neofusicoccum cryptoaustrale isolate PEL05 beta-tubulin (BT) gene, partial cds | 441 | 67.8% | 850.883 | 0.00e+00 | 99.3% |
| 129 | MT592736 | Neofusicoccum stellenboschiana culture CBS:133326 beta-tubulin (tub2) gene, partial cds | 441 | 67.8% | 850.883 | 0.00e+00 | 99.3% |
| 130 | JN191293 | Neofusicoccum australe isolate Nau-1 beta-tubulin gene, partial cds | 441 | 67.8% | 850.883 | 0.00e+00 | 99.3% |
| 131 | KY000212 | Neofusicoccum cryptoaustrale isolate PEL19 beta-tubulin (BT) gene, partial cds | 441 | 67.8% | 850.883 | 0.00e+00 | 99.3% |
| 132 | GQ857668 | Neofusicoccum australe strain UCR739 beta-tubulin gene, partial sequence | 440 | 67.7% | 846.918 | 0.00e+00 | 99.3% |
| 133 | MT592737 | Neofusicoccum stellenboschiana culture CBS:139666 beta-tubulin (tub2) gene, partial cds | 437 | 67.2% | 842.954 | 0.00e+00 | 99.3% |
| 134 | MT592689 | Neofusicoccum luteum culture CBS:133502 beta-tubulin (tub2) gene, partial cds | 434 | 66.8% | 837.007 | 0.00e+00 | 99.3% |
| 135 | MT592741 | Neofusicoccum stellenboschiana culture CPC:35286 beta-tubulin (tub2) gene, partial cds | 433 | 66.6% | 835.025 | 0.00e+00 | 99.3% |
| 136 | KY000208 | Neofusicoccum cryptoaustrale isolate PEL09 beta-tubulin (BT) gene, partial cds | 432 | 66.5% | 833.043 | 0.00e+00 | 99.3% |
| 137 | HQ392762 | Neofusicoccum luteum isolate HH197-1 beta-tubulin gene, partial sequence | 432 | 66.5% | 833.043 | 0.00e+00 | 99.3% |
| 138 | KY000211 | Neofusicoccum cryptoaustrale isolate PEL17 beta-tubulin (BT) gene, partial cds | 432 | 66.5% | 833.043 | 0.00e+00 | 99.3% |
| 139 | KY000186 | Neofusicoccum cryptoaustrale isolate EL14 beta-tubulin (BT) gene, partial cds | 431 | 66.3% | 831.06 | 0.00e+00 | 99.3% |
| 140 | MZ520703 | Neofusicoccum cryptoaustrale isolate Nc.LIB07 beta-tubulin gene, partial cds | 431 | 66.3% | 831.06 | 0.00e+00 | 99.3% |
| 141 | MZ520704 | Neofusicoccum cryptoaustrale isolate Nc.LIB09 beta-tubulin gene, partial cds | 431 | 66.3% | 831.06 | 0.00e+00 | 99.3% |
| 142 | KY000210 | Neofusicoccum cryptoaustrale isolate PEL16 beta-tubulin (BT) gene, partial cds | 431 | 66.3% | 831.06 | 0.00e+00 | 99.3% |
| 143 | KY000207 | Neofusicoccum cryptoaustrale isolate PEL07 beta-tubulin (BT) gene, partial cds | 430 | 66.2% | 829.078 | 0.00e+00 | 99.3% |
| 144 | KY000209 | Neofusicoccum cryptoaustrale isolate PEL10 beta-tubulin (BT) gene, partial cds | 430 | 66.2% | 829.078 | 0.00e+00 | 99.3% |
| 145 | KY000206 | Neofusicoccum cryptoaustrale isolate PEL06 beta-tubulin (BT) gene, partial cds | 430 | 66.2% | 829.078 | 0.00e+00 | 99.3% |
| 146 | KY000171 | Neofusicoccum cryptoaustrale isolate PED04 beta-tubulin (BT) gene, partial cds | 430 | 66.2% | 829.078 | 0.00e+00 | 99.3% |
| 147 | PP393547 | Neofusicoccum stellenboschiana isolate UCD10840 beta-tubulin (tub2) gene, partial cds | 429 | 66.0% | 827.096 | 0.00e+00 | 99.3% |
| 148 | PP393546 | Neofusicoccum stellenboschiana isolate UCD10568 beta-tubulin (tub2) gene, partial cds | 429 | 66.0% | 827.096 | 0.00e+00 | 99.3% |
| 149 | KY000203 | Neofusicoccum cryptoaustrale isolate PEL01 beta-tubulin (BT) gene, partial cds | 429 | 66.0% | 827.096 | 0.00e+00 | 99.3% |
| 150 | KX464959 | Neofusicoccum cryptoaustrale culture CBS:121559 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 825.113 | 0.00e+00 | 99.3% |
| 151 | MT592738 | Neofusicoccum stellenboschiana culture CBS:189.28 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 823.131 | 0.00e+00 | 99.3% |
| 152 | OP764457 | Neofusicoccum cryptoaustrale isolate AVORAM4 beta-tubulin gene beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 823.131 | 0.00e+00 | 99.3% |
| 153 | OP764456 | Neofusicoccum cryptoaustrale isolate AVORAM3 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 823.131 | 0.00e+00 | 99.3% |
| 154 | OP764458 | Neofusicoccum cryptoaustrale isolate AVORAM5 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 823.131 | 0.00e+00 | 99.3% |
| 155 | MT592735 | Neofusicoccum stellenboschiana culture CBS:118839 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 823.131 | 0.00e+00 | 99.3% |
| 156 | OP764454 | Neofusicoccum cryptoaustrale isolate AVORAM1 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 823.131 | 0.00e+00 | 99.3% |
| 157 | OP764455 | Neofusicoccum cryptoaustrale isolate AVORAM2 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 823.131 | 0.00e+00 | 99.3% |
| 158 | OM222705 | Neofusicoccum cryptoaustrale isolate Wn-4 beta-tubulin gene, partial cds | 422 | 64.9% | 813.22 | 0.00e+00 | 99.3% |
| 159 | AY615149 | Botryosphaeria australis isolate CMW3386 beta-tubulin gene, exons 3 through 6 and partial cds | 420 | 64.6% | 809.255 | 0.00e+00 | 99.3% |
| 160 | KM103186 | Neofusicoccum cryptoaustrale strain CMW35461 beta-tubulin gene, partial cds | 420 | 64.6% | 809.255 | 0.00e+00 | 99.3% |
| 161 | KM103198 | Neofusicoccum cryptoaustrale strain CMW35509 beta-tubulin gene, partial cds | 419 | 64.5% | 807.273 | 0.00e+00 | 99.3% |
| 162 | JN017909 | Neofusicoccum luteum isolate NZFS3232 beta-tubulin gene, partial sequence | 419 | 64.5% | 807.273 | 0.00e+00 | 99.3% |
| 163 | MW419253 | Neofusicoccum luteum strain CPC27961 beta-tubulin gene, partial cds | 413 | 63.5% | 795.38 | 0.00e+00 | 99.3% |
| 164 | AY339251 | Botryosphaeria lutea CMW10310 beta tubulin gene, exons 3 through 6 and partial cds | 412 | 63.4% | 793.397 | 0.00e+00 | 99.3% |
| 165 | OQ181387 | Neofusicoccum luteum isolate B024 beta-tubulin (TUB2) gene, partial cds | 411 | 63.2% | 791.415 | 0.00e+00 | 99.3% |
| 166 | MZ476039 | Neofusicoccum luteum isolate F34K-HB beta-tubulin (tub2) gene, partial cds | 411 | 63.2% | 791.415 | 0.00e+00 | 99.3% |
| 167 | OQ181386 | Neofusicoccum luteum isolate B003 beta-tubulin (TUB2) gene, partial cds | 411 | 63.2% | 791.415 | 0.00e+00 | 99.3% |
| 168 | MZ476038 | Neofusicoccum luteum isolate F34K-LF beta-tubulin (tub2) gene, partial cds | 410 | 63.1% | 789.433 | 0.00e+00 | 99.3% |
| 169 | DQ233625 | Botryosphaeria lutea strain UCD2057Te beta-tubulin gene, partial cds | 409 | 62.9% | 787.45 | 0.00e+00 | 99.3% |
| 170 | JF271781 | Neofusicoccum luteum strain UCR1177 beta-tubulin gene, partial sequence | 403 | 62.0% | 775.557 | 0.00e+00 | 99.3% |
| 171 | JF921874 | Neofusicoccum luteum isolate UCR1192 beta-tubulin gene, partial cds | 397 | 61.1% | 763.663 | 0.00e+00 | 99.2% |
| 172 | MZ073936 | Neofusicoccum laricinum strain MAFF 410183 beta-tubulin (tub2) gene, partial cds | 650 | 100.0% | 1241.39 | 0.00e+00 | 99.1% |
| 173 | MZ073937 | Neofusicoccum laricinum strain MAFF 410188 beta-tubulin (tub2) gene, partial cds | 650 | 100.0% | 1241.39 | 0.00e+00 | 99.1% |
| 174 | KX871763 | Neofusicoccum luteum strain CAA720 beta-tubulin gene, partial cds | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 175 | KX871759 | Neofusicoccum luteum strain CAA365 beta-tubulin gene, partial cds | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 176 | KX871760 | Neofusicoccum luteum strain CAA379 beta-tubulin gene, partial cds | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 177 | HQ392761 | Neofusicoccum luteum isolate HH119-1 beta-tubulin gene, partial sequence | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 178 | KX871756 | Neofusicoccum luteum strain CAA352 beta-tubulin gene, partial cds | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 179 | KY000204 | Neofusicoccum luteum isolate PEL04 beta-tubulin (BT) gene, partial cds | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 180 | KX871758 | Neofusicoccum luteum strain CAA362 beta-tubulin gene, partial cds | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 181 | DQ458848 | Botryosphaeria lutea strain CBS110299 beta-tubulin gene, partial cds | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 182 | HQ392751 | Neofusicoccum luteum isolate FF23-1 beta-tubulin gene, partial sequence | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 183 | HQ392741 | Neofusicoccum luteum isolate BB127-1 beta-tubulin gene, partial sequence | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 184 | KX871761 | Neofusicoccum luteum strain CAA412 beta-tubulin gene, partial cds | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 185 | KX871755 | Neofusicoccum luteum strain CAA203 beta-tubulin gene, partial cds | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 186 | KY436375 | Neofusicoccum luteum isolate Nl37 beta-tubulin gene, partial cds | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 187 | KX505929 | Neofusicoccum luteum strain CAA628 beta-tubulin gene, partial cds | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 188 | KX871754 | Neofusicoccum luteum strain CAA200 beta-tubulin gene, partial cds | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 189 | JF271777 | Neofusicoccum australe strain UCR1111 beta-tubulin gene, partial sequence | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 190 | KX871757 | Neofusicoccum luteum strain CAA360 beta-tubulin gene, partial cds | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 191 | KX871762 | Neofusicoccum luteum strain CAA505 beta-tubulin gene, partial cds | 441 | 67.8% | 842.954 | 0.00e+00 | 99.1% |
| 192 | MH118938 | Neofusicoccum luteum isolate EFA 469 beta-tubulin (tub2) gene, partial cds | 438 | 67.4% | 837.007 | 0.00e+00 | 99.1% |
| 193 | MT592696 | Neofusicoccum luteum culture CPC:35437 beta-tubulin (tub2) gene, partial cds | 438 | 67.4% | 837.007 | 0.00e+00 | 99.1% |
| 194 | KY000177 | Neofusicoccum luteum isolate PED16 beta-tubulin (BT) gene, partial cds | 432 | 66.5% | 825.113 | 0.00e+00 | 99.1% |
| 195 | ON086293 | Neofusicoccum australe strain ICMP 18452 beta-tubulin (btub) gene, partial cds | 432 | 66.5% | 825.113 | 0.00e+00 | 99.1% |
| 196 | HQ392737 | Neofusicoccum luteum isolate BB29-1 beta-tubulin gene, partial sequence | 432 | 66.5% | 825.113 | 0.00e+00 | 99.1% |
| 197 | KY000200 | Neofusicoccum luteum isolate EL56 beta-tubulin (BT) gene, partial cds | 432 | 66.5% | 825.113 | 0.00e+00 | 99.1% |
| 198 | KY000215 | Neofusicoccum luteum isolate PEL27 beta-tubulin (BT) gene, partial cds | 432 | 66.5% | 825.113 | 0.00e+00 | 99.1% |
| 199 | KY000185 | Neofusicoccum luteum isolate EL12 beta-tubulin (BT) gene, partial cds | 431 | 66.3% | 823.131 | 0.00e+00 | 99.1% |
| 200 | KY000142 | Neofusicoccum luteum isolate RB13 beta-tubulin (BT) gene, partial cds | 431 | 66.3% | 823.131 | 0.00e+00 | 99.1% |
| 201 | KY000175 | Neofusicoccum luteum isolate PED12 beta-tubulin (BT) gene, partial cds | 430 | 66.2% | 821.149 | 0.00e+00 | 99.1% |
| 202 | AY339249 | Botryosphaeria lutea CMW9076 beta tubulin gene, exons 3 through 6 and partial cds | 430 | 66.2% | 821.149 | 0.00e+00 | 99.1% |
| 203 | HQ392746 | Neofusicoccum luteum isolate BB161-2 beta-tubulin gene, partial sequence | 430 | 66.2% | 821.149 | 0.00e+00 | 99.1% |
| 204 | KY000179 | Neofusicoccum luteum isolate PED27 beta-tubulin (BT) gene, partial cds | 430 | 66.2% | 821.149 | 0.00e+00 | 99.1% |
| 205 | JX898982 | Neofusicoccum luteum isolate UCR1273 beta-tubulin gene, partial cds | 429 | 66.0% | 819.167 | 0.00e+00 | 99.1% |
| 206 | HQ392752 | Neofusicoccum luteum isolate H12-1 beta-tubulin gene, partial sequence | 429 | 66.0% | 819.167 | 0.00e+00 | 99.1% |
| 207 | JX898980 | Neofusicoccum luteum isolate UCR1211 beta-tubulin gene, partial cds | 429 | 66.0% | 819.167 | 0.00e+00 | 99.1% |
| 208 | PP393544 | Neofusicoccum luteum isolate UCD9262 beta-tubulin (tub2) gene, partial cds | 429 | 66.0% | 819.167 | 0.00e+00 | 99.1% |
| 209 | HQ392750 | Neofusicoccum luteum isolate BB192-1 beta-tubulin gene, partial sequence | 429 | 66.0% | 819.167 | 0.00e+00 | 99.1% |
| 210 | PP393545 | Neofusicoccum luteum isolate UCD9279 beta-tubulin (tub2) gene, partial cds | 429 | 66.0% | 819.167 | 0.00e+00 | 99.1% |
| 211 | KX464966 | Neofusicoccum luteum culture CBS:110487 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 817.184 | 0.00e+00 | 99.1% |
| 212 | OP764453 | Neofusicoccum luteum isolate AVF8 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 817.184 | 0.00e+00 | 99.1% |
| 213 | OP764449 | Neofusicoccum luteum isolate AVF3 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 817.184 | 0.00e+00 | 99.1% |
| 214 | JX898985 | Neofusicoccum luteum isolate UCR1340 beta-tubulin gene, partial cds | 428 | 65.8% | 817.184 | 0.00e+00 | 99.1% |
| 215 | KX464956 | Neofusicoccum luteum culture CBS:655.77 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 817.184 | 0.00e+00 | 99.1% |
| 216 | OP764450 | Neofusicoccum luteum isolate AVF5 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 817.184 | 0.00e+00 | 99.1% |
| 217 | OP764451 | Neofusicoccum luteum isolate AVF6 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 817.184 | 0.00e+00 | 99.1% |
| 218 | OP764452 | Neofusicoccum luteum isolate AVF7 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 817.184 | 0.00e+00 | 99.1% |
| 219 | JX898983 | Neofusicoccum luteum isolate UCR1275 beta-tubulin gene, partial cds | 428 | 65.8% | 817.184 | 0.00e+00 | 99.1% |
| 220 | MT592693 | Neofusicoccum luteum culture CPC:32388 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 815.202 | 0.00e+00 | 99.1% |
| 221 | KY000217 | Neofusicoccum luteum isolate PEL42 beta-tubulin (BT) gene, partial cds | 427 | 65.7% | 815.202 | 0.00e+00 | 99.1% |
| 222 | MT592694 | Neofusicoccum luteum culture CPC:32641 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 815.202 | 0.00e+00 | 99.1% |
| 223 | JX898981 | Neofusicoccum luteum isolate UCR1214 beta-tubulin gene, partial cds | 427 | 65.7% | 815.202 | 0.00e+00 | 99.1% |
| 224 | MH006968 | Neofusicoccum luteum isolate palb2022 beta-tubulin gene, partial cds | 427 | 65.7% | 815.202 | 0.00e+00 | 99.1% |
| 225 | OP209981 | Neofusicoccum australe isolate SS1 beta-tubulin (BT) gene, partial cds | 428 | 65.8% | 815.202 | 0.00e+00 | 99.1% |
| 226 | MH006967 | Neofusicoccum luteum isolate palb2018 beta-tubulin gene, partial cds | 427 | 65.7% | 815.202 | 0.00e+00 | 99.1% |
| 227 | JX898979 | Neofusicoccum luteum isolate UCR1359 beta-tubulin gene, partial cds | 426 | 65.5% | 813.22 | 0.00e+00 | 99.1% |
| 228 | OQ714614 | Neofusicoccum luteum isolate C9 beta-tubulin (tub2) gene, partial cds | 425 | 65.4% | 811.238 | 0.00e+00 | 99.1% |
| 229 | JX898984 | Neofusicoccum luteum isolate UCR1336 beta-tubulin gene, partial cds | 423 | 65.1% | 807.273 | 0.00e+00 | 99.1% |
| 230 | MT592699 | Neofusicoccum mangroviorum culture CBS:140739 beta-tubulin (tub2) gene, partial cds | 493 | 75.8% | 938.102 | 0.00e+00 | 99.0% |
| 231 | AY339250 | Botryosphaeria lutea CMW10309 beta tubulin gene, exons 3 through 6 and partial cds | 420 | 64.6% | 801.326 | 0.00e+00 | 99.0% |
| 232 | PP105773 | Neofusicoccum luteum strain BOT1 beta-tubulin (tub2) gene, partial cds | 420 | 64.6% | 801.326 | 0.00e+00 | 99.0% |
| 233 | PQ665326 | Neofusicoccum stellenboschiana isolate SuRDC2371 beta-tubulin (tub2) gene, partial cds | 438 | 67.4% | 837.007 | 0.00e+00 | 98.9% |
| 234 | GQ857665 | Neofusicoccum australe strain UCR509 beta-tubulin gene, partial sequence | 441 | 67.8% | 835.025 | 0.00e+00 | 98.9% |
| 235 | MH006966 | Neofusicoccum luteum isolate palb2017 beta-tubulin gene, partial cds | 427 | 65.7% | 811.238 | 0.00e+00 | 98.8% |
| 236 | OP209978 | Neofusicoccum australe isolate SS2 beta-tubulin (BT) gene, partial cds | 425 | 65.4% | 803.309 | 0.00e+00 | 98.8% |
| 237 | HQ529730 | Neofusicoccum luteum isolate UCR654 beta-tubulin gene, partial sequence | 441 | 67.8% | 829.078 | 0.00e+00 | 98.6% |
| 238 | MT592687 | Neofusicoccum luteum culture CBS:110862 beta-tubulin (tub2) gene, partial cds | 441 | 67.8% | 827.096 | 0.00e+00 | 98.6% |
| 239 | MT592698 | Neofusicoccum mangroviorum culture CBS:140738 beta-tubulin (tub2) gene, partial cds | 438 | 67.4% | 821.149 | 0.00e+00 | 98.6% |
| 240 | MT592700 | Neofusicoccum mangroviorum culture CBS:140740 beta-tubulin (tub2) gene, partial cds | 435 | 66.9% | 815.202 | 0.00e+00 | 98.6% |
| 241 | KY000174 | Neofusicoccum luteum isolate PED11 beta-tubulin (BT) gene, partial cds | 431 | 66.3% | 807.273 | 0.00e+00 | 98.6% |
| 242 | MT592685 | Neofusicoccum lumnitzerae culture CBS:139675 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 799.344 | 0.00e+00 | 98.6% |
| 243 | MT592701 | Neofusicoccum mangroviorum culture CPC:32482 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 799.344 | 0.00e+00 | 98.6% |
| 244 | MT592697 | Neofusicoccum mangroviorum culture CBS:111492 beta-tubulin (tub2) gene, partial cds | 426 | 65.5% | 797.362 | 0.00e+00 | 98.6% |
| 245 | MT592702 | Neofusicoccum mangroviorum culture CPC:32580 beta-tubulin (tub2) gene, partial cds | 426 | 65.5% | 797.362 | 0.00e+00 | 98.6% |
| 246 | HQ529728 | Neofusicoccum luteum isolate UCR539 beta-tubulin gene, partial sequence | 442 | 68.0% | 823.131 | 0.00e+00 | 98.4% |
| 247 | HQ529727 | Neofusicoccum luteum isolate UCR516 beta-tubulin gene, partial sequence | 441 | 67.8% | 819.167 | 0.00e+00 | 98.4% |
| 248 | HQ529731 | Neofusicoccum luteum isolate UCR548 beta-tubulin gene, partial sequence | 441 | 67.8% | 819.167 | 0.00e+00 | 98.4% |
| 249 | GU251832 | Dichomera eucalypti strain PD290 beta tubulin gene, partial cds | 489 | 75.2% | 898.457 | 0.00e+00 | 98.2% |
| 250 | HQ529733 | Neofusicoccum luteum isolate UCR526 beta-tubulin gene, partial sequence | 441 | 67.8% | 809.255 | 0.00e+00 | 98.2% |
| 251 | MT592718 | Neofusicoccum rapaneae culture CBS:145973 beta-tubulin (tub2) gene, partial cds | 435 | 66.9% | 799.344 | 0.00e+00 | 98.2% |
| 252 | MT592719 | Neofusicoccum rapaneae culture CPC:32578 beta-tubulin (tub2) gene, partial cds | 430 | 66.2% | 789.433 | 0.00e+00 | 98.1% |
| 253 | MT592720 | Neofusicoccum rapaneae culture CPC:35288 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 783.486 | 0.00e+00 | 98.1% |
| 254 | KX505922 | Neofusicoccum vitifusiforme strain B8 beta-tubulin gene, partial cds | 441 | 67.8% | 803.309 | 0.00e+00 | 98.0% |
| 255 | HQ529732 | Neofusicoccum luteum isolate UCR524 beta-tubulin gene, partial sequence | 441 | 67.8% | 801.326 | 0.00e+00 | 98.0% |
| 256 | GQ857664 | Botryosphaeria lutea strain UCR211 beta-tubulin gene, partial sequence | 439 | 67.5% | 801.326 | 0.00e+00 | 98.0% |
| 257 | KX465010 | Neofusicoccum sp. CBS 118100 culture CBS:118100 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 777.539 | 0.00e+00 | 97.9% |
| 258 | MT592730 | Neofusicoccum protearum culture CPC:28239 beta-tubulin (tub2) gene, partial cds | 424 | 65.2% | 769.61 | 0.00e+00 | 97.9% |
| 259 | EF591949 | Dichomera eucalypti strain MUCC498 beta-tubulin gene, partial sequence | 422 | 64.9% | 765.646 | 0.00e+00 | 97.9% |
| 260 | MT592745 | Neofusicoccum ursorum culture CBS:131680 beta-tubulin (tub2) gene, partial cds | 650 | 100.0% | 1177.96 | 0.00e+00 | 97.8% |
| 261 | HQ529726 | Neofusicoccum luteum isolate UCR455 beta-tubulin gene, partial sequence | 441 | 67.8% | 801.326 | 0.00e+00 | 97.8% |
| 262 | KX505924 | Neofusicoccum mediterraneum strain CAA001 beta-tubulin gene, partial cds | 441 | 67.8% | 795.38 | 0.00e+00 | 97.7% |
| 263 | MT592746 | Neofusicoccum vitifusiforme culture CBS:121113 beta-tubulin (tub2) gene, partial cds | 441 | 67.8% | 795.38 | 0.00e+00 | 97.7% |
| 264 | HQ529729 | Neofusicoccum luteum isolate UCR594 beta-tubulin gene, partial sequence | 441 | 67.8% | 795.38 | 0.00e+00 | 97.7% |
| 265 | KX505926 | Neofusicoccum mediterraneum strain SPA9 beta-tubulin gene, partial cds | 441 | 67.8% | 795.38 | 0.00e+00 | 97.7% |
| 266 | OP561953 | Neofusicoccum mediterraneum isolate UCD10439 beta-tubulin gene, partial cds | 440 | 67.7% | 793.397 | 0.00e+00 | 97.7% |
| 267 | MT592732 | Neofusicoccum protearum culture CBS:115198 beta-tubulin (tub2) gene, partial cds | 438 | 67.4% | 789.433 | 0.00e+00 | 97.7% |
| 268 | JQ080551 | Neofusicoccum mediterraneum strain UCRF11 beta-tubulin gene, partial sequence | 433 | 66.6% | 779.521 | 0.00e+00 | 97.7% |
| 269 | MN839590 | Neofusicoccum mediterraneum isolate ColPat-454 beta-tubulin gene, partial cds | 432 | 66.5% | 777.539 | 0.00e+00 | 97.7% |
| 270 | KF886726 | Neofusicoccum vitifusiforme strain CMW18666 beta-tubulin gene, partial cds | 432 | 66.5% | 777.539 | 0.00e+00 | 97.7% |
| 271 | KF886725 | Neofusicoccum vitifusiforme strain CMW18655 beta-tubulin gene, partial cds | 431 | 66.3% | 775.557 | 0.00e+00 | 97.7% |
| 272 | MT592744 | Neofusicoccum ursorum culture CBS:131679 beta-tubulin (tub2) gene, partial cds | 430 | 66.2% | 773.575 | 0.00e+00 | 97.7% |
| 273 | PP393548 | Neofusicoccum vitifusiforme isolate UCD9240 beta-tubulin (tub2) gene, partial cds | 429 | 66.0% | 771.592 | 0.00e+00 | 97.7% |
| 274 | OP561951 | Neofusicoccum mediterraneum isolate UCD9433 beta-tubulin gene, partial cds | 429 | 66.0% | 771.592 | 0.00e+00 | 97.7% |
| 275 | PP393549 | Neofusicoccum vitifusiforme isolate UCD9258 beta-tubulin (tub2) gene, partial cds | 429 | 66.0% | 771.592 | 0.00e+00 | 97.7% |
| 276 | MZ358268 | Neofusicoccum mediterraneum isolate P25 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 277 | KX464957 | Neofusicoccum corticosae culture CBS:118099 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 278 | MZ358313 | Neofusicoccum mediterraneum isolate P111 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 279 | MZ358308 | Neofusicoccum mediterraneum isolate P104 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 280 | MZ358294 | Neofusicoccum mediterraneum isolate P75 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 281 | MZ358301 | Neofusicoccum mediterraneum isolate P95 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 282 | KX465052 | Neofusicoccum mediterraneum culture CBS:125263 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 283 | MZ358306 | Neofusicoccum mediterraneum isolate P102 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 284 | MZ358303 | Neofusicoccum mediterraneum isolate P98 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 285 | MZ358315 | Neofusicoccum mediterraneum isolate P113 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 286 | MZ358288 | Neofusicoccum mediterraneum isolate P68 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 287 | MZ358270 | Neofusicoccum mediterraneum isolate P28 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 288 | MZ358311 | Neofusicoccum mediterraneum isolate P108 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 289 | MZ358292 | Neofusicoccum mediterraneum isolate P73 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 290 | MZ358291 | Neofusicoccum mediterraneum isolate P71 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 291 | MZ358275 | Neofusicoccum mediterraneum isolate P37 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 292 | MZ358309 | Neofusicoccum mediterraneum isolate P105 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 293 | MZ358289 | Neofusicoccum mediterraneum isolate P69 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 294 | MZ358290 | Neofusicoccum mediterraneum isolate P70 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 295 | MZ358298 | Neofusicoccum mediterraneum isolate P92 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 296 | KP217071 | Neofusicoccum hellenicum strain CERC1953 beta-tubulin gene, exons 3 through 6 and partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 297 | MZ358302 | Neofusicoccum mediterraneum isolate P97 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 298 | KP217069 | Neofusicoccum hellenicum strain CERC1947 beta-tubulin gene, exons 3 through 6 and partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 299 | MZ358316 | Neofusicoccum mediterraneum isolate P115 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 300 | MZ358304 | Neofusicoccum mediterraneum isolate P99 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 301 | MZ358286 | Neofusicoccum mediterraneum isolate P66 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 302 | MZ358276 | Neofusicoccum mediterraneum isolate P38 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 303 | KP217070 | Neofusicoccum hellenicum strain CERC1948 beta-tubulin gene, exons 3 through 6 and partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 304 | MZ358305 | Neofusicoccum mediterraneum isolate P101 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 305 | KP217073 | Neofusicoccum hellenicum strain CERC1959 beta-tubulin gene, exons 3 through 6 and partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 306 | MZ358278 | Neofusicoccum mediterraneum isolate P41 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 307 | MZ358285 | Neofusicoccum mediterraneum isolate P65 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 308 | MZ358310 | Neofusicoccum mediterraneum isolate P107 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 309 | KX465062 | Neofusicoccum vitifusiforme culture CBS:121111 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 310 | MZ358282 | Neofusicoccum mediterraneum isolate P50 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 311 | KX465056 | Neofusicoccum ursorum culture CBS:122811 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 312 | MZ358307 | Neofusicoccum mediterraneum isolate P103 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 313 | MZ358269 | Neofusicoccum mediterraneum isolate P27 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 314 | KX465036 | Neofusicoccum sp. 7 JZG-2016 culture CBS:121424 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 315 | MZ358312 | Neofusicoccum mediterraneum isolate P110 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 316 | KX465017 | Neofusicoccum sp. 2 JZG-2016 culture CBS:113081 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 317 | MZ358295 | Neofusicoccum mediterraneum isolate P76 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 318 | MZ358300 | Neofusicoccum mediterraneum isolate P94 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 319 | MZ358299 | Neofusicoccum mediterraneum isolate P93 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 320 | KX465035 | Neofusicoccum sp. 6 JZG-2016 culture CBS:111999 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 321 | KP217072 | Neofusicoccum hellenicum strain CERC1957 beta-tubulin gene, exons 3 through 6 and partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 322 | MZ358277 | Neofusicoccum mediterraneum isolate P40 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 323 | MZ358314 | Neofusicoccum mediterraneum isolate P112 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 324 | MZ358279 | Neofusicoccum mediterraneum isolate P43 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 769.61 | 0.00e+00 | 97.7% |
| 325 | MT592731 | Neofusicoccum protearum culture CBS:115177 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 767.628 | 0.00e+00 | 97.7% |
| 326 | MZ358264 | Neofusicoccum hellenicum isolate P109 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 767.628 | 0.00e+00 | 97.7% |
| 327 | MT592748 | Neofusicoccum vitifusiforme culture CBS:125789 beta-tubulin (tub2) gene, partial cds | 427 | 65.7% | 767.628 | 0.00e+00 | 97.7% |
| 328 | GU251836 | Neofusicoccum mediterraneum strain PD312 beta tubulin gene, partial cds | 489 | 75.2% | 874.67 | 0.00e+00 | 97.5% |
| 329 | MT592728 | Neofusicoccum protearum culture CBS:115499 beta-tubulin (tub2) gene, partial cds | 448 | 68.9% | 801.326 | 0.00e+00 | 97.5% |
| 330 | MT592723 | Neofusicoccum protearum culture CBS:113071 beta-tubulin (tub2) gene, partial cds | 442 | 68.0% | 789.433 | 0.00e+00 | 97.5% |
| 331 | MT592724 | Neofusicoccum protearum culture CBS:113076 beta-tubulin (tub2) gene, partial cds | 442 | 68.0% | 789.433 | 0.00e+00 | 97.5% |
| 332 | MN318106 | Neofusicoccum mediterraneum isolate KARE1302 beta-tubulin gene, partial cds | 441 | 67.8% | 787.45 | 0.00e+00 | 97.5% |
| 333 | MN839592 | Neofusicoccum mediterraneum isolate ColPat-613 beta-tubulin gene, partial cds | 441 | 67.8% | 787.45 | 0.00e+00 | 97.5% |
| 334 | MN839597 | Neofusicoccum mediterraneum isolate ColPat-641 beta-tubulin gene, partial cds | 441 | 67.8% | 787.45 | 0.00e+00 | 97.5% |
| 335 | MN839593 | Neofusicoccum mediterraneum isolate ColPat-626 beta-tubulin gene, partial cds | 441 | 67.8% | 787.45 | 0.00e+00 | 97.5% |
| 336 | MN839596 | Neofusicoccum mediterraneum isolate ColPat-640 beta-tubulin gene, partial cds | 441 | 67.8% | 787.45 | 0.00e+00 | 97.5% |
| 337 | MN318104 | Neofusicoccum mediterraneum isolate KARE1460 beta-tubulin gene, partial cds | 441 | 67.8% | 787.45 | 0.00e+00 | 97.5% |
| 338 | MN839594 | Neofusicoccum mediterraneum isolate ColPat-627 beta-tubulin gene, partial cds | 441 | 67.8% | 787.45 | 0.00e+00 | 97.5% |
| 339 | MN839595 | Neofusicoccum mediterraneum isolate ColPat-639 beta-tubulin gene, partial cds | 441 | 67.8% | 787.45 | 0.00e+00 | 97.5% |
| 340 | ON407018 | Neofusicoccum vitifusiforme isolate PV-709 beta-tubulin gene, partial cds | 441 | 67.8% | 785.468 | 0.00e+00 | 97.5% |
| 341 | PQ665323 | Dothiorella iberica isolate SuRDC2399 beta-tubulin (tub2) gene, partial cds | 440 | 67.7% | 785.468 | 0.00e+00 | 97.5% |
| 342 | MZ358322 | Neofusicoccum mediterraneum isolate P123 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 761.681 | 0.00e+00 | 97.4% |
| 343 | KX464998 | Neofusicoccum pistaciarum culture CBS:113083 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 761.681 | 0.00e+00 | 97.4% |
| 344 | KX465019 | Neofusicoccum sp. 2 JZG-2016 culture CBS:113086 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 761.681 | 0.00e+00 | 97.4% |
| 345 | KX465058 | Neofusicoccum viticlavatum culture CBS:112878 beta-tubulin (TUB2) gene, partial cds | 428 | 65.8% | 761.681 | 0.00e+00 | 97.4% |
| 346 | MZ358321 | Neofusicoccum mediterraneum isolate P122 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 761.681 | 0.00e+00 | 97.4% |
| 347 | MZ358271 | Neofusicoccum mediterraneum isolate P29 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 761.681 | 0.00e+00 | 97.4% |
| 348 | KF778913 | Neofusicoccum mediterraneum strain 1L85 beta-tubulin gene, exons 3 through 6 and partial cds | 428 | 65.8% | 761.681 | 0.00e+00 | 97.4% |
| 349 | MZ358280 | Neofusicoccum mediterraneum isolate P44 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 761.681 | 0.00e+00 | 97.4% |
| 350 | KF778906 | Neofusicoccum mediterraneum strain 1H96 beta-tubulin gene, exons 3 through 6 and partial cds | 428 | 65.8% | 761.681 | 0.00e+00 | 97.4% |
| 351 | MZ358283 | Neofusicoccum mediterraneum isolate P63 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 761.681 | 0.00e+00 | 97.4% |
| 352 | MZ358319 | Neofusicoccum mediterraneum isolate P119 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 761.681 | 0.00e+00 | 97.4% |
| 353 | MZ358265 | Neofusicoccum mediterraneum isolate P21 beta-tubulin (tub2) gene, partial cds | 428 | 65.8% | 761.681 | 0.00e+00 | 97.4% |
| 354 | MW890133 | Neofusicoccum mystacidii strain CPC:39221 beta-tubulin (tub2) gene, partial cds | 587 | 90.3% | 1037.22 | 0.00e+00 | 97.3% |
| 355 | GU251837 | Neofusicoccum mediterraneum strain PD1 beta tubulin gene, partial cds | 489 | 75.2% | 866.741 | 0.00e+00 | 97.3% |
| 356 | FJ238525 | Botryosphaeria parva strain SDAU07-16 beta-tubulin gene, partial sequence | 441 | 67.8% | 779.521 | 0.00e+00 | 97.3% |
| 357 | HQ859954 | Neofusicoccum parvum strain CDZ1-1s3 beta-tubulin gene, partial cds | 441 | 67.8% | 779.521 | 0.00e+00 | 97.3% |
| 358 | OR776997 | Neofusicoccum parvum isolate ZJUP1112-1 beta-tubulin (tub2) gene, partial cds | 441 | 67.8% | 779.521 | 0.00e+00 | 97.3% |
| 359 | KC960985 | Neofusicoccum parvum strain DS2921 beta-tubulin (BT) gene, partial cds | 441 | 67.8% | 779.521 | 0.00e+00 | 97.3% |
| 360 | GU062767 | Neofusicoccum sp. B794 beta-tubulin gene, partial sequence | 441 | 67.8% | 779.521 | 0.00e+00 | 97.3% |
| 361 | KU997612 | Neofusicoccum parvum isolate MAR24128 beta-tubulin gene, partial cds | 441 | 67.8% | 779.521 | 0.00e+00 | 97.3% |
| 362 | PQ227811 | Neofusicoccum parvum isolate YBF5-1 beta-tubulin (TUB) gene, partial cds | 441 | 67.8% | 779.521 | 0.00e+00 | 97.3% |
| 363 | OL456719 | Neofusicoccum parvum strain 413G-19 beta-tubulin (btub) gene, partial cds | 441 | 67.8% | 779.521 | 0.00e+00 | 97.3% |
| 364 | KX505913 | Neofusicoccum sp. CAA192 beta-tubulin gene, partial cds | 441 | 67.8% | 779.521 | 0.00e+00 | 97.3% |
| 365 | KX505918 | Neofusicoccum nonquaesitum strain IMI500168 beta-tubulin gene, partial cds | 441 | 67.8% | 779.521 | 0.00e+00 | 97.3% |
| 366 | MN318109 | Neofusicoccum parvum isolate KARE599 beta-tubulin gene, partial cds | 441 | 67.8% | 779.521 | 0.00e+00 | 97.3% |
| 367 | OL415487 | Neofusicoccum parvum isolate 414G-19 beta-tubulin (btub) gene, partial cds | 441 | 67.8% | 779.521 | 0.00e+00 | 97.3% |
| 368 | KY000132 | Neofusicoccum parvum isolate MTZ31 beta-tubulin (BT) gene, partial cds | 441 | 67.8% | 779.521 | 0.00e+00 | 97.3% |
| 369 | OL790430 | Neofusicoccum parvum strain WHG-3 beta-tubulin gene, partial cds | 441 | 67.8% | 779.521 | 0.00e+00 | 97.3% |
| 370 | ON041445 | Neofusicoccum parvum strain YJX beta-tubulin (TUB) gene, partial cds | 441 | 67.8% | 779.521 | 0.00e+00 | 97.3% |
| 371 | MT592725 | Neofusicoccum protearum culture CBS:113079 beta-tubulin (tub2) gene, partial cds | 440 | 67.7% | 777.539 | 0.00e+00 | 97.3% |
| 372 | OR551974 | Neofusicoccum parvum isolate B7 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 777.539 | 0.00e+00 | 97.3% |
| 373 | OR551978 | Neofusicoccum parvum isolate B12 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 777.539 | 0.00e+00 | 97.3% |
| 374 | OR551969 | Neofusicoccum parvum isolate B1 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 777.539 | 0.00e+00 | 97.3% |
| 375 | OR551972 | Neofusicoccum parvum isolate B5 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 777.539 | 0.00e+00 | 97.3% |
| 376 | OR551971 | Neofusicoccum parvum isolate B3 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 777.539 | 0.00e+00 | 97.3% |
| 377 | KU997613 | Neofusicoccum parvum isolate MAR24138 beta-tubulin gene, partial cds | 440 | 67.7% | 777.539 | 0.00e+00 | 97.3% |
| 378 | OR551973 | Neofusicoccum parvum isolate B6 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 775.557 | 0.00e+00 | 97.3% |
| 379 | MT592646 | Neofusicoccum parvum culture CBS:139672 beta-tubulin (tub2) gene, partial cds | 437 | 67.2% | 771.592 | 0.00e+00 | 97.3% |
| 380 | OL539662 | Neofusicoccum mediterraneum voucher CREA-DC TPR OL.427 beta-tubulin (TUB2) gene, partial cds | 633 | 97.4% | 1110.56 | 0.00e+00 | 97.2% |
| 381 | KP690738 | Neofusicoccum mangiferae isolate QIUQE3 beta-tubulin gene, partial cds | 606 | 93.2% | 1066.95 | 0.00e+00 | 97.2% |
| 382 | KY435929 | Neofusicoccum mangiferae strain wbhs2 beta-tubulin gene, partial cds | 620 | 95.4% | 1084.79 | 0.00e+00 | 97.1% |
| 383 | MT592729 | Neofusicoccum protearum culture CPC:29008 beta-tubulin (tub2) gene, partial cds | 553 | 85.1% | 967.836 | 0.00e+00 | 97.1% |
| 384 | GU251835 | Neofusicoccum mediterraneum strain PD311 beta tubulin gene, partial cds | 489 | 75.2% | 858.812 | 0.00e+00 | 97.1% |
| 385 | GU251816 | Neofusicoccum nonquaesitum strain PD86 beta tubulin gene, partial cds | 489 | 75.2% | 858.812 | 0.00e+00 | 97.1% |
| 386 | JX462257 | Neofusicoccum parvum strain AH-3-1-01s beta-tubulin (BT) gene, partial cds | 441 | 67.8% | 771.592 | 0.00e+00 | 97.1% |
| 387 | HQ859953 | Neofusicoccum parvum strain CDZ1-1s2 beta-tubulin gene, partial cds | 441 | 67.8% | 771.592 | 0.00e+00 | 97.1% |
| 388 | HQ840417 | Neofusicoccum parvum strain CDZ1-1s1 beta-tubulin gene, partial cds | 441 | 67.8% | 771.592 | 0.00e+00 | 97.1% |
| 389 | GQ857667 | Neofusicoccum parvum strain UCR531 beta-tubulin gene, partial sequence | 441 | 67.8% | 771.592 | 0.00e+00 | 97.1% |
| 390 | GU997687 | Neofusicoccum parvum strain SDAU08-55 beta-tubulin gene, partial sequence | 441 | 67.8% | 771.592 | 0.00e+00 | 97.1% |
| 391 | HQ529738 | Neofusicoccum arbuti isolate UCR749 beta-tubulin gene, partial sequence | 441 | 67.8% | 771.592 | 0.00e+00 | 97.1% |
| 392 | KC960987 | Neofusicoccum parvum strain DL2611 beta-tubulin (BT) gene, partial cds | 441 | 67.8% | 771.592 | 0.00e+00 | 97.1% |
| 393 | GQ857666 | Neofusicoccum parvum strain UCR737 beta-tubulin gene, partial sequence | 440 | 67.7% | 769.61 | 0.00e+00 | 97.1% |
| 394 | ON773422 | Neofusicoccum parvum isolate LSCKS8-7 beta-tubulin gene, partial cds | 634 | 97.5% | 1106.59 | 0.00e+00 | 97.0% |
| 395 | ON773421 | Neofusicoccum parvum isolate LSCKS8-6 beta-tubulin gene, partial cds | 634 | 97.5% | 1106.59 | 0.00e+00 | 97.0% |
| 396 | ON773420 | Neofusicoccum parvum isolate LSCKS8-5 beta-tubulin gene, partial cds | 634 | 97.5% | 1106.59 | 0.00e+00 | 97.0% |
| 397 | KU530157 | Neofusicoccum parvum strain GEVB10 beta-tubulin gene, partial cds | 608 | 93.5% | 1062.99 | 0.00e+00 | 97.0% |
| 398 | OR551983 | Neofusicoccum parvum isolate B23 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 769.61 | 0.00e+00 | 97.0% |
| 399 | OR551985 | Neofusicoccum parvum isolate Ba-5 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 769.61 | 0.00e+00 | 97.0% |
| 400 | OR551984 | Neofusicoccum parvum isolate Ba-3 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 769.61 | 0.00e+00 | 97.0% |
| 401 | OR551975 | Neofusicoccum parvum isolate B9 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 769.61 | 0.00e+00 | 97.0% |
| 402 | ON773426 | Neofusicoccum parvum isolate LSCKS8-2 beta-tubulin 2 gene, partial cds | 650 | 100.0% | 1130.38 | 0.00e+00 | 96.9% |
| 403 | ON773428 | Neofusicoccum parvum isolate LSCKS8-4 beta-tubulin 2 gene, partial cds | 650 | 100.0% | 1130.38 | 0.00e+00 | 96.9% |
| 404 | ON773427 | Neofusicoccum parvum isolate LSCKS8-3 beta-tubulin 2 gene, partial cds | 650 | 100.0% | 1130.38 | 0.00e+00 | 96.9% |
| 405 | MW266970 | Neofusicoccum parvum strain CY2 beta-tubulin gene, partial cds | 642 | 98.8% | 1114.52 | 0.00e+00 | 96.9% |
| 406 | MW266972 | Neofusicoccum parvum strain BM12 beta-tubulin gene, partial cds | 642 | 98.8% | 1114.52 | 0.00e+00 | 96.9% |
| 407 | MW625871 | Neofusicoccum parvum beta-tubulin (tub2) gene, partial cds | 621 | 95.5% | 1080.83 | 0.00e+00 | 96.9% |
| 408 | MK563987 | Neofusicoccum parvum isolate LY-J beta-tubulin gene, partial cds | 621 | 95.5% | 1080.83 | 0.00e+00 | 96.9% |
| 409 | OQ939558 | Neofusicoccum parvum strain A-95-19 beta-tubulin gene, partial cds | 611 | 94.0% | 1061.0 | 0.00e+00 | 96.9% |
| 410 | OQ939557 | Neofusicoccum parvum strain A-92-19 beta-tubulin gene, partial cds | 611 | 94.0% | 1061.0 | 0.00e+00 | 96.9% |
| 411 | OQ994781 | Neofusicoccum parvum strain MEND-F-0377 beta-tubulin (tub2) gene, partial cds | 608 | 93.5% | 1055.06 | 0.00e+00 | 96.9% |
| 412 | OP066357 | Neofusicoccum sp. voucher 202105041 beta-tubulin (TUB) gene, partial cds | 581 | 89.4% | 1009.46 | 0.00e+00 | 96.9% |
| 413 | OP066359 | Neofusicoccum sp. voucher 202105043-1 beta-tubulin (TUB) gene, partial cds | 581 | 89.4% | 1009.46 | 0.00e+00 | 96.9% |
| 414 | OP066358 | Neofusicoccum sp. voucher 202105043 beta-tubulin (TUB) gene, partial cds | 581 | 89.4% | 1009.46 | 0.00e+00 | 96.9% |
| 415 | KC507808 | Neofusicoccum parvum strain CCF216 beta-tubulin gene, partial cds | 649 | 99.8% | 1120.47 | 0.00e+00 | 96.8% |
| 416 | OQ401701 | Neofusicoccum parvum strain MEND-F-1154 beta-tubulin (tub2) gene, partial cds | 601 | 92.5% | 1041.18 | 0.00e+00 | 96.8% |
| 417 | OQ401702 | Neofusicoccum parvum strain MEND-F-1155 beta-tubulin (tub2) gene, partial cds | 600 | 92.3% | 1039.2 | 0.00e+00 | 96.8% |
| 418 | OP066363 | Neofusicoccum sp. voucher 202105009 beta-tubulin (TUB) gene, partial cds | 595 | 91.5% | 1029.29 | 0.00e+00 | 96.8% |
| 419 | OP066361 | Neofusicoccum sp. voucher 202105052 beta-tubulin (TUB) gene, partial cds | 595 | 91.5% | 1029.29 | 0.00e+00 | 96.8% |
| 420 | OP066362 | Neofusicoccum sp. voucher 202108015 beta-tubulin (TUB) gene, partial cds | 498 | 76.6% | 860.794 | 0.00e+00 | 96.8% |
| 421 | OL589061 | Neofusicoccum parvum isolate MXH8 beta-tubulin (TUB2) gene, partial cds | 468 | 72.0% | 809.255 | 0.00e+00 | 96.8% |
| 422 | KY000117 | Neofusicoccum parvum isolate MAN55 beta-tubulin (BT) gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 423 | OM397540 | Neofusicoccum parvum isolate BJ111.4 beta-tubulin (tub2) gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 424 | MN536687 | Neofusicoccum parvum isolate H23 beta-tubulin (BT) gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 425 | KX871765 | Neofusicoccum algeriense strain PE32 beta-tubulin gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 426 | OL455947 | Neofusicoccum parvum isolate 7b beta-tubulin (tub2) gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 427 | OM397539 | Neofusicoccum parvum isolate BJ111.1 beta-tubulin (tub2) gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 428 | OL455946 | Neofusicoccum parvum isolate 7a beta-tubulin (tub2) gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 429 | KR260807 | Neofusicoccum parvum strain L12 beta-tubulin (BT) gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 430 | GU121842 | Neofusicoccum parvum strain IRN7 beta-tubulin 2 gene, partial sequence | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 431 | KU997598 | Neofusicoccum umdonicola isolate MAR212116 beta-tubulin gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 432 | OQ989636 | Neofusicoccum parvum strain NP8 beta-tubulin (Bt) gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 433 | ON082774 | Neofusicoccum sinoeucalypti strain JABY22 beta-tubulin gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 434 | KX505915 | Neofusicoccum algeriense strain CBS 137504 beta-tubulin gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 435 | EU673095 | Neofusicoccum parvum strain CBS 110301 beta-tubulin gene, partial sequence | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 436 | MN318108 | Neofusicoccum parvum isolate KARE1198 beta-tubulin gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 437 | KY000128 | Neofusicoccum parvum isolate MTZ06 beta-tubulin (BT) gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 438 | MK294085 | Neofusicoccum parvum isolate 294 beta-tubulin gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 439 | JX462272 | Neofusicoccum parvum strain SCCDJF01S beta-tubulin (BT) gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 440 | MN839599 | Neofusicoccum parvum isolate ColPat-615 beta-tubulin gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 441 | KX871764 | Neofusicoccum algeriense strain CAA366 beta-tubulin gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 442 | GU062768 | Neofusicoccum sp. B946 beta-tubulin gene, partial sequence | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 443 | MN539189 | Neofusicoccum sinoeucalypti strain GBLZ16BO-006 beta-tubulin (TUB2) gene, partial cds | 441 | 67.8% | 763.663 | 0.00e+00 | 96.8% |
| 444 | OR551822 | Neofusicoccum parvum isolate NTZE19 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 761.681 | 0.00e+00 | 96.8% |
| 445 | OR551815 | Neofusicoccum parvum isolate NTZE6 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 761.681 | 0.00e+00 | 96.8% |
| 446 | OR551824 | Neofusicoccum parvum isolate NTZE31 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 761.681 | 0.00e+00 | 96.8% |
| 447 | OR551840 | Neofusicoccum parvum isolate KuL4 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 761.681 | 0.00e+00 | 96.8% |
| 448 | OR551773 | Neofusicoccum parvum isolate L1-1 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 761.681 | 0.00e+00 | 96.8% |
| 449 | OR551828 | Neofusicoccum parvum isolate NTZE38 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 761.681 | 0.00e+00 | 96.8% |
| 450 | OR551827 | Neofusicoccum parvum isolate NTZE37 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 761.681 | 0.00e+00 | 96.8% |
| 451 | OR551812 | Neofusicoccum parvum isolate Zai-6 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 761.681 | 0.00e+00 | 96.8% |
| 452 | OR551793 | Neofusicoccum parvum isolate LK3-3 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 761.681 | 0.00e+00 | 96.8% |
| 453 | OR551825 | Neofusicoccum parvum isolate NTZE32 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 761.681 | 0.00e+00 | 96.8% |
| 454 | OR551819 | Neofusicoccum parvum isolate NTZE-14 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 761.681 | 0.00e+00 | 96.8% |
| 455 | OR551816 | Neofusicoccum parvum isolate NTZE-10 beta-tubulin (BT) gene, partial cds | 440 | 67.7% | 761.681 | 0.00e+00 | 96.8% |
| 456 | OQ579010 | Neofusicoccum parvum isolate IRNHM-BT23 beta-tubulin (TUB2) gene, partial cds | 640 | 98.5% | 1102.63 | 0.00e+00 | 96.7% |
| 457 | GU251803 | Neofusicoccum parvum strain PD17 beta tubulin gene, partial cds | 489 | 75.2% | 842.954 | 0.00e+00 | 96.7% |
| 458 | OQ420443 | Neofusicoccum parvum strain KARE1463 beta-tubulin (BT) gene, partial cds | 650 | 100.0% | 1114.52 | 0.00e+00 | 96.6% |
| 459 | MG879024 | Neofusicoccum parvum strain LW43-2 beta-tubulin gene, partial cds | 650 | 100.0% | 1114.52 | 0.00e+00 | 96.6% |
| 460 | MG879025 | Neofusicoccum parvum strain LW45-1 beta-tubulin gene, partial cds | 650 | 100.0% | 1114.52 | 0.00e+00 | 96.6% |
| 461 | OP594295 | Neofusicoccum parvum isolate WN5-191 beta-tubulin (TUB) gene, partial cds | 644 | 99.1% | 1102.63 | 0.00e+00 | 96.6% |
| 462 | OP594292 | Neofusicoccum parvum isolate WN5-172 beta-tubulin (TUB) gene, partial cds | 644 | 99.1% | 1102.63 | 0.00e+00 | 96.6% |
| 463 | OP594293 | Neofusicoccum parvum isolate WN5-188 beta-tubulin (TUB) gene, partial cds | 644 | 99.1% | 1102.63 | 0.00e+00 | 96.6% |
| 464 | OP594294 | Neofusicoccum parvum isolate WN5-190 beta-tubulin (TUB) gene, partial cds | 644 | 99.1% | 1102.63 | 0.00e+00 | 96.6% |
| 465 | OP594291 | Neofusicoccum parvum isolate WN5-161 beta-tubulin (TUB) gene, partial cds | 644 | 99.1% | 1102.63 | 0.00e+00 | 96.6% |
| 466 | OP594296 | Neofusicoccum parvum isolate WNNT01 beta-tubulin (TUB) gene, partial cds | 644 | 99.1% | 1102.63 | 0.00e+00 | 96.6% |
| 467 | KC507806 | Neofusicoccum parvum strain CCF109 beta-tubulin gene, partial cds | 643 | 98.9% | 1100.65 | 0.00e+00 | 96.6% |
| 468 | MW266974 | Neofusicoccum parvum strain BM10 beta-tubulin gene, partial cds | 642 | 98.8% | 1098.67 | 0.00e+00 | 96.6% |
| 469 | MW266973 | Neofusicoccum parvum strain BM9 beta-tubulin gene, partial cds | 642 | 98.8% | 1098.67 | 0.00e+00 | 96.6% |
| 470 | OQ939555 | Neofusicoccum parvum strain A-61-14 beta-tubulin gene, partial cds | 615 | 94.6% | 1053.07 | 0.00e+00 | 96.6% |
| 471 | KJ841779 | Neofusicoccum parvum strain NpS92 beta-tubulin gene, partial cds | 584 | 89.8% | 999.553 | 0.00e+00 | 96.6% |
| 472 | ON568670 | Neofusicoccum parvum strain 22_20_O beta-tubulin (tub2) gene, partial cds | 526 | 80.9% | 900.439 | 0.00e+00 | 96.6% |
| 473 | MG745803 | Neofusicoccum mediterraneum isolate Bot-04 beta-tubulin gene, partial cds | 441 | 67.8% | 767.628 | 0.00e+00 | 96.6% |
| 474 | ON098141 | Neofusicoccum parvum strain JAMH13 beta-tubulin gene, partial cds | 632 | 97.2% | 1078.84 | 0.00e+00 | 96.5% |
| 475 | OQ994782 | Neofusicoccum parvum strain MEND-F-0374 beta-tubulin (tub2) gene, partial cds | 608 | 93.5% | 1039.2 | 0.00e+00 | 96.5% |
| 476 | OQ994784 | Neofusicoccum parvum strain MEND-F-0384 beta-tubulin (tub2) gene, partial cds | 608 | 93.5% | 1039.2 | 0.00e+00 | 96.5% |
| 477 | OQ994783 | Neofusicoccum parvum strain MEND-F-0373 beta-tubulin (tub2) gene, partial cds | 608 | 93.5% | 1039.2 | 0.00e+00 | 96.5% |
| 478 | OQ994780 | Neofusicoccum parvum strain MEND-F-0376 beta-tubulin (tub2) gene, partial cds | 608 | 93.5% | 1039.2 | 0.00e+00 | 96.5% |
| 479 | OM039456 | Neofusicoccum parvum beta-tubulin (tub1) gene, partial cds | 598 | 92.0% | 1019.38 | 0.00e+00 | 96.5% |
| 480 | GU251809 | Neofusicoccum arbuti strain PD244 beta tubulin gene, partial cds | 489 | 75.2% | 835.025 | 0.00e+00 | 96.5% |
| 481 | MW266971 | Neofusicoccum parvum strain ZL4 beta-tubulin gene, partial cds | 642 | 98.8% | 1090.74 | 0.00e+00 | 96.4% |
| 482 | OL694623 | Neofusicoccum parvum beta-tubulin (tub) gene, partial cds | 639 | 98.3% | 1084.79 | 0.00e+00 | 96.4% |
| 483 | OM801237 | Neofusicoccum parvum strain JAMK beta-tubulin gene, partial cds | 632 | 97.2% | 1068.93 | 0.00e+00 | 96.4% |
| 484 | MG970283 | Neofusicoccum parvum isolate MEKA205 beta-tubulin (BT) gene, partial cds | 499 | 76.8% | 846.918 | 0.00e+00 | 96.4% |
| 485 | GU251783 | Neofusicoccum parvum strain PD250 beta tubulin gene, partial cds | 489 | 75.2% | 827.096 | 0.00e+00 | 96.3% |
| 486 | MT409397 | Neofusicoccum parvum strain YYcbCZ beta-tubulin gene, partial cds | 489 | 75.2% | 827.096 | 0.00e+00 | 96.3% |
| 487 | MN963816 | Neofusicoccum parvum isolate DBL-1 beta-tubulin gene, partial cds | 553 | 85.1% | 930.173 | 0.00e+00 | 96.2% |
| 488 | GU251787 | Neofusicoccum ribis strain PD288 beta tubulin gene, partial cds | 489 | 75.2% | 819.167 | 0.00e+00 | 96.1% |
| 489 | MT592679 | Neofusicoccum batangarum culture CPC:29624 beta-tubulin (tub2) gene, partial cds | 650 | 100.0% | 1082.81 | 0.00e+00 | 96.0% |
| 490 | MT592680 | Neofusicoccum batangarum culture CPC:29625 beta-tubulin (tub2) gene, partial cds | 650 | 100.0% | 1082.81 | 0.00e+00 | 96.0% |
| 491 | KC507807 | Neofusicoccum kwambonambiense strain CCF110 beta-tubulin gene, partial cds | 645 | 99.2% | 1070.91 | 0.00e+00 | 96.0% |
| 492 | KU984493 | Neofusicoccum parvum strain THS5-20 beta-tubulin gene, partial cds | 629 | 96.8% | 1049.11 | 0.00e+00 | 96.0% |
| 493 | MT592743 | Neofusicoccum umdonicola culture CPC:29626 beta-tubulin (tub2) gene, partial cds | 640 | 98.5% | 1062.99 | 0.00e+00 | 95.9% |
| 494 | GU251788 | Neofusicoccum ribis strain PD289 beta tubulin gene, partial cds | 489 | 75.2% | 811.238 | 0.00e+00 | 95.9% |
| 495 | GU251804 | Neofusicoccum parvum strain PD39 beta tubulin gene, partial cds | 489 | 75.2% | 811.238 | 0.00e+00 | 95.9% |
| 496 | MK246814 | Neofusicoccum kwambonambiense beta-tubulin gene, partial cds | 647 | 99.5% | 1066.95 | 0.00e+00 | 95.8% |
| 497 | GU251807 | Neofusicoccum ribis strain PD299 beta tubulin gene, partial cds | 489 | 75.2% | 803.309 | 0.00e+00 | 95.7% |
| 498 | GU251784 | Neofusicoccum parvum strain PD251 beta tubulin gene, partial cds | 489 | 75.2% | 803.309 | 0.00e+00 | 95.7% |
| 499 | GU251786 | Neofusicoccum ribis strain PD254 beta tubulin gene, partial cds | 489 | 75.2% | 795.38 | 0.00e+00 | 95.5% |
| 500 | MN850331 | Neofusicoccum parvum isolate ZD51 beta-tubulin (BT1) gene, partial cds | 646 | 99.4% | 1035.23 | 0.00e+00 | 95.2% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
The boxplot above shows the distribution of BLAST hits identity within each genus. Each data point shows the alignment identity between the query sequence and reference sequence. The analyst may wish to refer to this figure when making a subjective genus-level identification for the sample.
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
No candidate species to report on.
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |